SG001

ID: SG001

Identification: Gobiidae sp.1

Stage: pre-flexion

Blast: Amblychaeturichthys hexanema

Sequence: GGGCCTTTAAATGATGTTTGGTGCATGAGCCGGCATAGTGGGCACGGCCTTAAGCCTTCTGATCCGAGCCGAACTAAGCCAACCCGGGGCACTCTTAGGGGATGACCAGATTTACAATGTAATCGTTACAGCCCATGCCTTTGTTATAATTTTTTTTATAGTTATACCCATCATAATTGGGGGCTTTGGGAATTGACTGGTCCCCCTAATAATTGGGGCCCCAGACATAGCCTTTCCCCGAATAAATAACATAAGTTTTTGACTTCTCCCGCCATCATTCCTACTACTCCTCTCTTCTTCAGGCGTAGAGGCCGGGGCTGGTACCGGATGAACTGTTTACCCGCCCTTAGCAGGAAACCTTGCCCATGCAGGGGCCTCTGTTGACTTAACAATTTTTTCCTTACACCTCGCCGGGATTTCATCTATTTTAGGTGCTATCAACTTTATCACGACTATTCTTAATATAAAACCCCCCGCAATAACACAGTACCAAACCCCTCTCTTTGTGTGGTCCGTGCTAATTACAGCCGTACTCTTACTTTTATCCCTTCCTGTACTCGCTGCCGGCATTACCATGCTTCTCACAGATCGAAACTTAAACACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACCTTTTCTGATTCTTTGGCCACCCAGAAGTCTAA

 

Leave a Reply

Your email address will not be published.

This site uses Akismet to reduce spam. Learn how your comment data is processed.