SG002

ID: SG002

Identification: Cynoglossus sp.1

Stage: pre-flexion

Blast: Cynoglossus abbreviatus

Sequence: GGGGCAAAAAAGTATTTGGCGCTTGGGCCGGAATAGTAGGAACTGCTCTCAGCCTACTAATTCGAGCAGAACTAAGCCAACCCGGCAGCCTGCTTGGCGACGACCAGATCTATAATGTAATTGTAACCGCCCATGCATTTGTCATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGCTTTGGTAATTGATTAATCCCCTTAATAATTGGAGCCCCCGATATAGCATTTCCTCGAATAAATAACATAAGCTTCTGACTTCTACCCCCCTCATTCCTCCTATTGTTGGCCTCATCTGCAGTAGAAGCTGGGGCTGGTACAGGATGAACCGTTTACCCCCCCCTTGCAGGAAATCTTGCCCATGCCGGAGCATCTGTAGACCTTACAATCTTCTCCCTTCATCTGGCTGGAATTTCCTCTATCTTGGGGGCTATCAACTTTATTACAACAGTTCTAAACATAAAACCTAAAGGGATATCAATATATCAAGTACCCCTGTTCGTCTGAGCAGTTTTTATTACAGCAATCCTCTTACTTCTCTCCTTACCTGTCTTAGCTGCTGGAATTACCATACTTCTCACGGATCGAAACTTAAACACAACCTTTTTTGACCCTGCTGGGGGAGGAGATCCTATTCTTTACCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTCTAA

Leave a Reply

Your email address will not be published.

This site uses Akismet to reduce spam. Learn how your comment data is processed.