SG018

D: SG018 Identification: egg unidentified sp.3 Stage: egg features: d=1.0mm, no oil globules Blast: Callionymus olidus Sequence: TTGGCAATTAATTATTTTTGGTGCTTGGGCCGGCATAGTCGGCACCGCCCTAAGTCTTCTTATTCGAGCAGAACTTAACCAACCGGGCGCTCTCCTGGGAGACGATCAAATTTATAATGTTATCGTCACCGCACACGCATTCGTAATGATTTTTTTTATAGTTATGCCCATCATAATTGGAGGGTTCGGAAATTGACTTATTCCCATAATAATCGGAGCCCCCGATATAGCTTTCCCTCGAATAAACAACATAAGTTTCTGACTTCTGCCCCCCTCCTTTCTTCTCCTTCTAGCCTCCTCAGGAGTAGAAGCTGGGGCAGGTACGGGATGAACTGTCTACCCCCCGTTATCAAGTAATCTTGCTCATGCAGGGGCTTCAGTAGACTTAACCATCTTCTCCCTACACCTAGCAGGGATCTCTTCTATTCTCGGGGCCATCAACTTTATCACAACAATTACAAACATGAAACCCCCCGCTCTAACTCAATACCAAACCCCCCTGTTCGTTTGAGCTGTGCTAATTACGGCCGTACTGCTACTTCTGTCCCTTCCCGTGCTTGCTGCAGGCATCACTATACTTCTCACAGACCGAAATTTAAATACTACTTTCTTCGATCCAGCGGGAGGAGGAGACCCCATTCTTTACCAACATCTTTTTTGATTCTTCGGCCACCCAGAAGT...

SG017

ID: SG017 Identification: egg unidentified sp.2 Stage: egg features: d=1.6mm, 15~20 oil globules Blast: Cynoglossus gracilis Sequence: GGGCCTTTCTAGTATTTGGTGCCTGAGCCGGATAGTAGGGACTGCTCTCAGCCTATTAATTCGAGCAGAACTGAGCCAACCCGGCAGCCTGCTTGGCGATGACCAAATTTACAATGTGATTGTAACCGCCCATGCATTTGTTATAATTTTCTTTATAGTCATACCTATTATAATTGGAGGTTTTGGTAATTGATTAATCCCTTTAATAATTGGAGCCCCTGACATAGCATTTCCTCGAATGAATAATATAAGCTTCTGACTTCTACCTCCTTCATTTCTTCTTCTATTAGCCTCATCCGCAGTAGAAGCTGGAGCTGGGACAGGATGAACTGTTTACCCTCCCCTTGCAGGGAATCTTGCCCATGCCGGGGCATCTGTAGACCTTACAATTTTCTCCCTTCATTTAGCTGGAGTTTCCTCTATCTTAGGAGCTATTAATTTTATTACAACAGTTCTAAACATAAAACCTGAAGGGATGACAATATACCAAATACCTTTGTTCGTCTGAGCAGTTTTTATTACGGCAATCCTTTTACTTCTCTCTTTACCTGTCCTAGCTGCAGGAATTACCATACTCCTTACAGATCGAAATTTGAACACTACCTTTTTTGACCCCGCTGGGGGTGGAGATCCAATTCTTTATCAACACCTATTCTGATTCTTCGGCCCCCCCAGAAGTA...

SG005

ID: SG005 Identification: Sebastiscus marmoratus Stage: pre-flexion Blast: Sebastiscus marmoratus Sequence: TTGGCCATATCTAGTATTTGGTGCCTGAGCCGGTATAGTGGGCACTGCCCTCAGCCTACTCATTCGAGCAGAATTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTACAATGTAATCGTTACAGCACATGCTTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATCGGAGCCCCAGATATAGCATTTCCTCGTATAAATAATATAAGTTTTTGACTTCTTCCCCCTTCTTTCCTTCTTCTGCTTGCCTCTTCCGGTGTAGAAGCGGGGGCCGGAACCGGATGAACAGTATATCCGCCCCTGGCTGGTAACTTAGCCCACGCAGGAGCCTCCGTAGACCTGACAATTTTCTCACTTCACCTGGCAGGTATTTCCTCAATCCTCGGGGCTATTAATTTTATTACCACAATTATTAACATAAAACCCCCAGCCATCTCTCAATACCAGACTCCCTTGTTTGTGTGAGCTGTTCTAATTACCGCTGTCCTTCTCCTTCTCTCCCTACCAGTTCTTGCTGCTGGCATCACAATGCTTCTAACAGACCGAAATCTGAATACTACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTCTTTATCAACATCTATTCTGATTCTTTGGCCACCCAGAAGTCTAA...

SG003

ID: SG003 Identification: Amblychaeturichthys hexanema Stage: post-flexion Blast: Amblychaeturichthys hexanema Sequence: GGGGCTTCAACTTGGATGTTTTGGTGCATGAGCCGGCATAGTGGGCACGGCCTTAAGCCTTCTGATCCGAGCCGAACTAAGCCAACCCGGGGCACTCTTAGGGGATGACCAGATCTACAACGTAATCGTTACAGCCCATGCCTTTGTTATAATTTTTTTTATAGTTATACCCATCATAATTGGGGGCTTTGGGAATTGACTGGTCCCCCTAATAATTGGGGCCCCAGACATAGCCTTTCCCCGAATAAATAACATAAGTTTTTGACTTCTCCCACCATCATTCCTACTACTCCTTTCTTCTTCAGGCGTAGAAGCCGGGGCTGGTACCGGATGAACTGTTTACCCGCCCTTAGCAGGAAACCTTGCCCATGCAGGGGCCTCTGTTGACTTAACAATTTTTTCCTTACACCTCGCCGGGATTTCATCTATTTTAGGTGCTATCAACTTTATCACGACTATTCTCAATATAAAACCCCCCGCAATAACACAGTACCAAACCCCTCTCTTTGTGTGGTCCGTACTAATTACAGCTGTACTCTTACTTTTATCTCTTCCTGTACTCGCTGCCGGCATTACCATGCTTCTCACAGATCGAAACTTAAACACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACCTTTTCTGATTCTTTGGCCACCCAGAAGTCTAA...