SG017

ID: SG017

Identification: egg unidentified sp.2

Stage: egg

features: d=1.6mm, 15~20 oil globules

Blast: Cynoglossus gracilis

Sequence: GGGCCTTTCTAGTATTTGGTGCCTGAGCCGGATAGTAGGGACTGCTCTCAGCCTATTAATTCGAGCAGAACTGAGCCAACCCGGCAGCCTGCTTGGCGATGACCAAATTTACAATGTGATTGTAACCGCCCATGCATTTGTTATAATTTTCTTTATAGTCATACCTATTATAATTGGAGGTTTTGGTAATTGATTAATCCCTTTAATAATTGGAGCCCCTGACATAGCATTTCCTCGAATGAATAATATAAGCTTCTGACTTCTACCTCCTTCATTTCTTCTTCTATTAGCCTCATCCGCAGTAGAAGCTGGAGCTGGGACAGGATGAACTGTTTACCCTCCCCTTGCAGGGAATCTTGCCCATGCCGGGGCATCTGTAGACCTTACAATTTTCTCCCTTCATTTAGCTGGAGTTTCCTCTATCTTAGGAGCTATTAATTTTATTACAACAGTTCTAAACATAAAACCTGAAGGGATGACAATATACCAAATACCTTTGTTCGTCTGAGCAGTTTTTATTACGGCAATCCTTTTACTTCTCTCTTTACCTGTCCTAGCTGCAGGAATTACCATACTCCTTACAGATCGAAATTTGAACACTACCTTTTTTGACCCCGCTGGGGGTGGAGATCCAATTCTTTATCAACACCTATTCTGATTCTTCGGCCCCCCCAGAAGTA

Leave a Reply

Your email address will not be published.

This site uses Akismet to reduce spam. Learn how your comment data is processed.