SG018

D: SG018

Identification: egg unidentified sp.3

Stage: egg

features: d=1.0mm, no oil globules

Blast: Callionymus olidus

Sequence: TTGGCAATTAATTATTTTTGGTGCTTGGGCCGGCATAGTCGGCACCGCCCTAAGTCTTCTTATTCGAGCAGAACTTAACCAACCGGGCGCTCTCCTGGGAGACGATCAAATTTATAATGTTATCGTCACCGCACACGCATTCGTAATGATTTTTTTTATAGTTATGCCCATCATAATTGGAGGGTTCGGAAATTGACTTATTCCCATAATAATCGGAGCCCCCGATATAGCTTTCCCTCGAATAAACAACATAAGTTTCTGACTTCTGCCCCCCTCCTTTCTTCTCCTTCTAGCCTCCTCAGGAGTAGAAGCTGGGGCAGGTACGGGATGAACTGTCTACCCCCCGTTATCAAGTAATCTTGCTCATGCAGGGGCTTCAGTAGACTTAACCATCTTCTCCCTACACCTAGCAGGGATCTCTTCTATTCTCGGGGCCATCAACTTTATCACAACAATTACAAACATGAAACCCCCCGCTCTAACTCAATACCAAACCCCCCTGTTCGTTTGAGCTGTGCTAATTACGGCCGTACTGCTACTTCTGTCCCTTCCCGTGCTTGCTGCAGGCATCACTATACTTCTCACAGACCGAAATTTAAATACTACTTTCTTCGATCCAGCGGGAGGAGGAGACCCCATTCTTTACCAACATCTTTTTTGATTCTTCGGCCACCCAGAAGT

Leave a Reply

Your email address will not be published.

This site uses Akismet to reduce spam. Learn how your comment data is processed.