SG005

ID: SG005

Identification: Sebastiscus marmoratus

Stage: pre-flexion

Blast: Sebastiscus marmoratus

Sequence: TTGGCCATATCTAGTATTTGGTGCCTGAGCCGGTATAGTGGGCACTGCCCTCAGCCTACTCATTCGAGCAGAATTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTACAATGTAATCGTTACAGCACATGCTTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATCGGAGCCCCAGATATAGCATTTCCTCGTATAAATAATATAAGTTTTTGACTTCTTCCCCCTTCTTTCCTTCTTCTGCTTGCCTCTTCCGGTGTAGAAGCGGGGGCCGGAACCGGATGAACAGTATATCCGCCCCTGGCTGGTAACTTAGCCCACGCAGGAGCCTCCGTAGACCTGACAATTTTCTCACTTCACCTGGCAGGTATTTCCTCAATCCTCGGGGCTATTAATTTTATTACCACAATTATTAACATAAAACCCCCAGCCATCTCTCAATACCAGACTCCCTTGTTTGTGTGAGCTGTTCTAATTACCGCTGTCCTTCTCCTTCTCTCCCTACCAGTTCTTGCTGCTGGCATCACAATGCTTCTAACAGACCGAAATCTGAATACTACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTCTTTATCAACATCTATTCTGATTCTTTGGCCACCCAGAAGTCTAA

Leave a Reply

Your email address will not be published.

This site uses Akismet to reduce spam. Learn how your comment data is processed.