SG003

ID: SG003

Identification: Amblychaeturichthys hexanema

Stage: post-flexion

Blast: Amblychaeturichthys hexanema

Sequence: GGGGCTTCAACTTGGATGTTTTGGTGCATGAGCCGGCATAGTGGGCACGGCCTTAAGCCTTCTGATCCGAGCCGAACTAAGCCAACCCGGGGCACTCTTAGGGGATGACCAGATCTACAACGTAATCGTTACAGCCCATGCCTTTGTTATAATTTTTTTTATAGTTATACCCATCATAATTGGGGGCTTTGGGAATTGACTGGTCCCCCTAATAATTGGGGCCCCAGACATAGCCTTTCCCCGAATAAATAACATAAGTTTTTGACTTCTCCCACCATCATTCCTACTACTCCTTTCTTCTTCAGGCGTAGAAGCCGGGGCTGGTACCGGATGAACTGTTTACCCGCCCTTAGCAGGAAACCTTGCCCATGCAGGGGCCTCTGTTGACTTAACAATTTTTTCCTTACACCTCGCCGGGATTTCATCTATTTTAGGTGCTATCAACTTTATCACGACTATTCTCAATATAAAACCCCCCGCAATAACACAGTACCAAACCCCTCTCTTTGTGTGGTCCGTACTAATTACAGCTGTACTCTTACTTTTATCTCTTCCTGTACTCGCTGCCGGCATTACCATGCTTCTCACAGATCGAAACTTAAACACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACCTTTTCTGATTCTTTGGCCACCCAGAAGTCTAA

Leave a Reply

Your email address will not be published.

This site uses Akismet to reduce spam. Learn how your comment data is processed.